FastA - a text-based format for storing sequences.
- Sequence identifier line, starting with β>β
- Followed by one or more lines of sequence data
Example of FASTA file
>seq1
ATCGATCGATCGATCGATCGATCGATCGATCG
>seq2
CGATCGATCGATCGATCGATCGATCGATCGATFastQ - text-based format for storing sequencing data (coming off a sequencer).
FASTQ stores each read in 4 lines:
- Sequence identifier, starting with β@β
- Raw sequence read
- Separator line, β+β
- Quality score of each nucleotide in the read, encoded as ASCII characters.
FASTQ can contain billions of reads and be very big in size.
FastQ file example from international genome
@ERR059938.60 HS9_6783:8:2304:19291:186369#7/2
GTCTCCGGGGGCTGGGGGAACCAGGGGTTCCCACCAACCACCCTCACTCAGCCTTTTCCCTCCAGGCATCTCTGGGAAAGGACATGGGGCTGGTGCGGGG
+
7?CIGJB:D:-F7LA:GI9FDHBIJ7,GHGJBKHNI7IN,EML8IFIA7HN7J6,L6686LCJE?JKA6G7AK6GK5C6@6IK+++?5+=<;227*6054