FastA FastQ Format

FastA - a text-based format for storing sequences.

• Sequence identifier line, starting with ”>”
• Followed by one or more lines of sequence data

Example of FASTA file

>seq1
ATCGATCGATCGATCGATCGATCGATCGATCG
>seq2
CGATCGATCGATCGATCGATCGATCGATCGAT

FastQ - text-based format for storing sequencing data (coming off a sequencer).

FASTQ stores each read in 4 lines:

1. Sequence identifier, starting with ”@”
2. Raw sequence read
3. Separator line, ”+”
4. Quality score of each nucleotide in the read, encoded as ASCII characters.

FASTQ can contain billions of reads and be very big in size.

FastQ file example from international genome

@ERR059938.60 HS9_6783:8:2304:19291:186369#7/2
GTCTCCGGGGGCTGGGGGAACCAGGGGTTCCCACCAACCACCCTCACTCAGCCTTTTCCCTCCAGGCATCTCTGGGAAAGGACATGGGGCTGGTGCGGGG
+
7?CIGJB:D:-F7LA:GI9FDHBIJ7,GHGJBKHNI7IN,EML8IFIA7HN7J6,L6686LCJE?JKA6G7AK6GK5C6@6IK+++?5+=<;227*6054